-Advertisement-
  About AE   About NHM   Contact Us   Terms of Use   Copyright Info   Privacy Policy   Advertising Policies   Site Map
   
Custom Search of AE Site
spacer spacer

Restriction Enzymes

By Linda Ellis



Restriction enzymes are enzymes that cut the sugar-phosphate of the DNA strand. They are "restricted" to certain sequences of bases. Each restriction enzyme will recognize only one "restriction site" and that is the only place it will cut. By using different restriction enzymes, you can cut the DNA at many different places.

ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGT GACTTCGATA
TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTGAAGCTAT

Start by finding and circling all of the recognition sites, GAATTC, in the top strand of this section of DNA. Circle (or rectangle!) both strands, including all of the letters in the recognition site.

Now look at the lower strand....what do you notice about the sequence of bases (letters)?

Words which are spelled the same forwards and backwards are called palindromes. Write some examples here!

In DNA, we call it a
palindromic sequence!
GAATTC

CTTAAG

Now, think about this..... if the restriction enzyme cuts each strand of DNA at the end of the sequence, that is, after the C, the cut ends will be single stranded

Use your scissors (restriction enzyme), and try it.

Take one of your restriction fragments and see if you can make the sticky end base pair with one of your neighbor's fragments. Do they match up??? As long as both molecules were "cut" with the same restriction enzyme, they should have the same sticky ends, even if the fragments are from different kinds of DNA, such as bacteria and humans. Another enzyme called ligase can be used to seal the strands together.

After making the cuts, how many fragments do you have?

There is a way to separate these fragments which is based on their size. It is called electrophoresis. The fragments have some excess negative charge, so they will be attracted to a positive electrical charge.

Smaller fragments move faster than large ones. If all of the fragments are put into a "well" in a gel, and the current is turned on, the smaller ones will get to the end of the gel first


On the gel above, mark the position of each of the fragments of your DNA in the first lane. "bp" stands for base pair. Count only the pairs, not the sticky ends.

Now, for some Nobel Prize type thinking.....what would happen if a mutation occured right in the middle of one of those recognition sequences??

What if a mutation resulted in the creation of a new recognition site??

Find the recognition sequences in the DNA strands below. Count the number of base pairs in each of the fragments which would form. Draw them in lanes 2 and 3.

Lane 2
ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGAATTCGATA TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTTAAGCTAT

Lane 3
ATTCGACGAGTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGACTTCGATAT TAAGCTGCTTCGCCATGGACTGATACCTTAAGCCACATGGAGTACACTAAAGCTATA

Alert Students .... Any questions or profound conclusions????




For the Instructor

These are extra copies of the DNA sequences. The first is the original one on the student's paper. The second and third are the ones with the mutations. They are in the same order as the ones on the kids paper.

DNA Sequence #1

ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGT GACTTCGATA TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTGAAGCTAT

DNA Sequence #2 (This has an additional restriction site)

ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGAATTCGATA TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTTAAGCTAT

DNA Sequence #3 (This has lost a restriction site)

ATTCGACGAGTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGACTTCGATAT TAAGCTGCTTCGCCATGGACTGATACCTTAAGCCACATGGAGTACACTAAAGCTATA

These are cut out and given to 3 different students as they arrive for class. Try to be sure that other kids don't know what is going on. Keep the bottom of the transparancy covered until you are ready for the first question. Tell the first person that he/she will be given a clue about when to ask the question. Ask the kids to do a little acting, and read them with some feeling, or meaning, or...or whatever!

Alert Student #1 raises hand as soon as I ask if any alert student has a question...If mutations occur fairly frequently, shouldn't that mean that there would be lots of changes in these restriction sites, even in DNA from the same species?

Alert Student #2 - right after the question is asked says...Hey, you can't just go around changing DNA all the time!!! What if you changed DNA that codes for really important proteins??

Brilliant Student who has really been paying attention jumps in with... I think I've got it! Mutations probably do occur in important regions of DNA. But the individual probably doesn't survive if that happens. However, since huge amounts of our DNA doesn't code for anything at all, changes in these noncoding regions would certainly have accumulated over the millions of years we have been evolving! So you are both right! Probably no two of us have exactly the same DNA....and this is a powerful tool for being able to distinguish between the DNA of different individuals!


Transparency Master

ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGT GACTTCGATA TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTGAAGCTAT

ATTCGACGAATTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGAATTCGATA TAAGCTGCTTAAGCCATGGACTGATACCTTAAGCCACATGGAGTACACTTAAGCTAT

ATTCGACGAGTCGGTACCTGACTATGGAATTCGGTGTACCTCATGTGACTTCGATAT TAAGCTGCTTCGCCATGGACTGATACCTTAAGCCACATGGAGTACACTAAAGCTATA


Is there an "alert student" with a question in the room?


Fellows Collection Index


Activities Exchange Index


 
Custom Search on the AE Site
-Advertisement-